4.4 Inhibition of enterovirus A71 infections by octaguanidinium-conjugated
Figure 4.26: Schematic illustrations of vivo-MO and the EV-A71 genomic structure.
(A) vivo-MO is an antisense structural type in which each subunit consists of a purine or pyrimidine base attached to a morpholino ring with a unique covalently-linked delivery moiety comprised of an octaguanidinium dendrimer (Moulton and Jiang, 2009). (B) Three genomic vivo-MOs target sequences (5’ to 3’), labeled (1), (2) and (3), are indicated within the proposed secondary structures of the IRES region and RdRP of EV-A71 RNA (upper part). The sequences of these three targeted regions were aligned across all EV-A71 genotypes, CV-A16 and PV (bottom part). Mismatched nucleotides are shown in red.
Table 4.3: The 23-mers vivo-MOs sequences and target locations in EV-A71 RNA Vivo-MO Sequence (5’- 3’) Target location in EV-A71
RNA (nucleotide position) Vivo-MO-1 CAGAGTTGCCCATTACGACACAC IRES core (512-534)
Vivo-MO-2 GAAACACGGACACCCAAAGTAGT IRES core (546-568) Vivo-MO-3 AAACAATTCGAGCCAATTTCTTC RdRP (7303-7325)
Vivo-MO-C CCTACTCCATCGTTCAGCTCTGA -
4.4.2 Inhibitory effects of vivo-MOs against enterovirus A71 infection
To evaluate the effects of vivo-MOs on EV-A71 infectivity in RD cells, RD cells were treated with vivo-MOs an hour after infection. As shown in Figure 4.27, both vivo-MOs targeting the EV-A71 IRES stem-loop region exhibited significant antiviral activity against EV-A71 infection with reduction of virus-induced CPE (Figure 4.27A), viral plaque formation (Figure 4.27B), RNA (Figure 4.27C) and protein expression (Figure 4.27D) in a dose-dependent manner. Vivo-MO-1 and vivo-MO-2 significantly reduced EV-A71 plaque formation by up to 2.7 and 3.5 log10 PFU/ml at 10 µM, respectively.
Significant inhibition was observed at concentrations higher than 1 µM. The IC50 values of vivo-MO-1 and vivo-MO-2 reported in this study were 1.5 µM and 1.2 µM, respectively. However, vivo-MO-3 exhibited less inhibitory effect against EV-A71 infection in RD cells with a plaque reduction of only 1.2 log10 PFU/ml.
Besides RD cells, vivo-MOs also inhibited EV-A71 in neuroepithelial SK-N-MC cells, but with reduced activity when compared to RD cells. This confirms that the antiviral effects are not cell-specific.
4.4.3 Cytotoxicity analysis of vivo-MOs in tissue culture
To measure the effects of vivo-MOs on cell viability, non-infected RD cells were treated with various concentrations of vivo-MOs for 24 hours in maintenance medium.
None of the three vivo-MOs caused more than 20% reduction of cell viability at concentrations less than 5 µM as measured by the MTS assay. Overall, vivo-MOs concentrations up to 5 µM showed minimal cytotoxicity to cells (Figure 4.28).
Figure 4.27, continued
Figure 4.27: Inhibitory effects of vivo-MOs in RD cells. Various concentrations of vivo-MOs were applied to RD cells after 1 hour post-infection and (A) virus-induced CPE (20 × magnification) was observed 24 hours post-infection. CPE was seen as round and shrunken cells, which eventually dislodged from the surface. The total infectious particles or total viral proteins were harvested 24 hours post-infection and evaluated by (B) plaque assay, (C) TaqMan real-time PCR and (D) western blot analysis.
EV-A71 viral capsid protein was detected by mouse anti-EV-A71 monoclonal antibody and cellular β-actin was detected using mouse anti-β-actin monoclonal antibody. Vivo-MO-C is the negative control with nonsense sequence.
Figure 4.28: Cell viability analysis of vivo-MOs. Various concentrations of vivo-MOs were incubated with RD cells for 24 hours in maintenance medium followed by MTS assay. The absorbance reading at 490 nm was obtained.
The percentage of cell viability (%) was determined by dividing the absorbance readings obtained from vivo-MO-treated over non-treated cells. The data presented are means of two biological replicates. Error bars indicate the standard deviation of mean.
4.4.4 Time of addition analysis
To further characterize the efficacy of vivo-MOs at multiple time points relative to EV-A71 infection, vivo-MOs were applied for 4 hours before, or at 0, 1, 2, 4, or 6 hours after EV-A71 infection. Both vivo-MO-1 and vivo-MO-2 remained effective when administered before or after EV-A71 infection. When vivo-MOs and EV-A71 were added together into the RD cells for 1 hour, the inhibitory effect was reduced, which could have resulted from the incomplete uptake of the vivo-MOs by the cells. However, the efficacies of vivo-MO-1 and vivo-MO-2 were reduced when treatments were delayed. Nonetheless, the antiviral effects were retained with 92.8% plaque inhibition, for both vivo-MO-1 and vivo-MO-2 even when administered 6 hours post-infection.
Vivo-MO-3 had no observable inhibitory effects on EV-A71 infection when administered 4 hours before infection and 2, 4, or 6 hours after EV-A71 infection (Figure 4.29).
4.4.5 Inhibitory effects of vivo-MOs against other enteroviruses
Next, the ability of the vivo-MOs to inhibit different EV-A71 strains and other picornaviruses were investigated. Each of the vivo-MOs was tested at a final concentration of 5 µM against two other EV-A71 strains (BrCr and UH1/97), PV, CV-A16 and CHIKV as the control virus. The vivo-MO-2 which targets the highly conserved region of the IRES stem-loop structure exhibited significant inhibitory activity against EV-A71 strains BrCr and UH1/97, PV and CV-A16 with viral plaque reduction ranging from 1.8 - 3.1 log10 PFU/ml (Figure 4.30). However, vivo-MO-1 only exhibited antiviral activities against EV-A71 strains BrCr and UH1/97, and CV-A16, but not against PV (Figure 4.30). EV-A71 strain BrCr which has a single nucleotide mismatch in the middle of the vivo-MO-1 targeted site (Figure 4.26B) remained sensitive to the vivo-MO-1 treatment. The efficacy of vivo-MO-1 against CV-A16 (0.95
log10PFU/ml reduction) was significantly lower when compared to EV-A71 (1.86 log10PFU/ml reduction). This could be due to CV-A16 having three nucleotide mismatches with the vivo-MO-1. PV with five nucleotide mismatches was completely resistant to the inhibitory effect of vivo-MO-1. The vivo-MO-C, which has no homologous sequence to the A71 genome, was not inhibitory at all against all EV-A71 strains tested. All the vivo-MOs did not show any inhibition of CHIKV infection.
Thus, the antiviral activities of vivo-MOs were sequence-specific.
4.4.6 Mechanism of action analysis of vivo-MOs
To investigate the mechanism of action of the antiviral vivo-MOs, cell-free translation analysis was used. In cell-free analysis, 1 µg of infectious RNA was in vitro translated either in the presence or absence of 10 µM of MOs. The presence of either vivo-MO-1 or vivo-MO-2 significantly blocked the in vitro translation of EV-A71 viral capsid proteins when compared to the control without vivo-MOs (Figure 4.31A). Vivo-MO-3 exhibited reduced efficacies as compared to IRES-targeting vivo-MOs (Figure 4.31A). In the EGFP reporter translation inhibition assay, the presence of vivo-MO-1 or vivo-MO-2 greatly reduced EGFP expression in RD cells 6 hours post-infection with EV-A71_EGFP (Figure 4.31B).
4.4.7 Isolation and characterization of vivo-MO-resistant mutants
Enteroviruses may escape antiviral effects through mutations (Shih et al., 2004b, de Palma et al., 2009). To determine whether EV-A71 could become resistant to vivo-MO treatments, EV-A71 was serially passaged in the presence of increasing concentrations of either vivo-MO-1 or vivo-MO-2. Interestingly, only EV-A71 mutants resistant to vivo-MO-1 were isolated after eight passages. EV-A71 mutants that were resistant to vivo-MO-2 could not be isolated, suggesting that the region targeted by vivo-MO-2 is critical for EV-A71 translation initiation.
4.4.8 Characterization of degree of tolerance of vivo-MO mismatches against enterovirus A71 infection
To investigate the determinant(s) of resistance, viral RNA was isolated from the resistant population and the 5’ UTR was sequenced. A single point mutation from T to C at position 533 was sufficient to confer resistance to vivo-MO-1 (Figure 4.32A). To characterize the loss of inhibitory activity by vivo-MO-1, EV-A71 mutants carrying various mismatches at the vivo-MO-1 target site were constructed (Table 4.4), and the inhibitory effects of vivo-MO-1 against each of the mutants were evaluated. The mismatched RNA target sequences were designed to reflect the most likely natural variations that would arise in the A71 sequence. As shown in Figure 4.32B, the EV-A71 MO-1-mutant-1, which carried a single point mutation at position 533 (T to C substitution), required higher vivo-MO-1 concentrations to achieve a similar inhibitory effect when compared to the wild type. The EV-A71 MO-1-mutant-2 with a single point mutation in the middle of the targeted sequence (a T to C substitution at position 523) remained sensitive to vivo-MO-1, but vivo-MO-1 had reduced inhibitory efficacy when compared with the wild type. Increasing the number of mutations on the targeted sequence significantly reduced the inhibitory efficacy of vivo-MO-1. The viral plaque inhibition at 2 µM of vivo-MO-1 against EV-A71 MO-1-WT was 98.9% ± 0.1, and reduced to 89.6% ± 3.4 for the MO-1-mutant-1 that carried a point mutation at the 3’
end of the target sequence. The viral plaque inhibition by vivo-MO-1 reduced to 78.0%
when the number of nucleotide mismatches increased to three.
Figure 4.29: The effect of time of addition on the antiviral properties of vivo-MOs.
Vivo-MOs at the final concentration of 5 µM were applied to RD cells at 4 hours before or 0, 1, 2, 4, 6 hours after EV-A71 infection at MOI of 0.1.
The data presented were obtained from at least two independent biological replicates. Error bars indicate standard deviation of the mean.
Percentage of inhibition at the time points -4, +1, and +6 are shown above the respective bars. Asterisks indicate statistically significant differences compared to the control, with p < 0.05.
Figure 4.30: The antiviral activities of vivo-MOs against multiple enteroviruses. RD cells were pre-treated with each of the vivo-MOs at a final concentration of 5 µM for 4 hours at 37°C before infection with various enteroviruses (EV-A71 strains BrCr and UH1/97, PV and CV-A16) and CHIKV at MOI of 0.1. The inhibitory effects of each of the vivo-MOs were evaluated by plaque assay 24 hours post-infection. The data presented were obtained from at least two independent biological replicates. Error bars indicate standard deviation of the mean. Asterisks indicate statistically significant differences compared to the control, with p < 0.05.
Figure 4.31: Translation inhibition assay. (A) In vitro translation was performed with 1 µg of RNA using the 1-Step Human Coupled IVT Kit either in the presence or absence of vivo-MOs at a final concentration of 10 µM.
Aliquots of 15 µl of the translated product was subjected to SDS-PAGE and western blot analysis. A 36 KDa band indicates expression of EV-A71 capsid protein. (B) EV-EV-A71_EGFP expression assay. RD cells were infected with EV-A71 at a MOI of 1 for an hour at 37°C, followed by treatment of vivo-MOs at the final concentration of 2.5 µM. The EGFP signal was detected 6 hours post-infection using a fluorescence microscope. EGFP expression and cell nuclei are presented as green and blue, respectively.
Table 4.4: The vivo-MO-1 sequence (3’ to 5’) and the in vitro transcribed infectious RNA with target sequences (5’ to 3’)
Target Sequence Mismatch(es)
Vivo-MO-1 3’-CACACAGCATTACCCGTTGAGAC-5’ -
MO-1-WT 5’-GTGTGTCGTAATGGGCAACTCTG-3’ 0
MO-1-mutant-1 5’-*********************C*-3’ 1 MO-1-mutant-2 5’-***********C***********-3’ 1 MO-1-mutant-3 5’-***********C***T*******-3’ 2 MO-1-mutant-4 5’-***C*******C***T*******-3’ 3
Figure 4.32: Vivo-MO-1 resistant mutant analysis. EV-A71 was serially passaged in the presence of vivo-MO-1 from 1 µM to 5 µM. EV-A71 populations that were resistant to vivo-MO-1 were plaque purified, and subjected to DNA sequencing. (A) The DNA sequences targeted by vivo-MO-1 are shown in the sequencing chromatograms. The arrow indicates the T to C substitution at position 533 of the vivo-MO-1 resistant mutant. (B) The effect of sequence mismatches between vivo-MO-1 and target RNA on the inhibition assay. Several in vitro transcribed RNA, each having a different number of nucleotide mismatches in the target region were analyzed. Viral titers were quantitated 24 hours post-infection by plaque assay. The data presented were obtained from at least two independent biological replicates.
CHAPTER 5
DISCUSSION